miRNA-17-5p Target Prediction and its Role in Senescence Mechanism through p21 Interference
DOI:
https://doi.org/10.3889/oamjms.2021.5986Keywords:
Cellular senescence, Cyclin-dependent kinase, In silico, miRNAAbstract
BACKGROUND: Cellular senescence is known to be correlated with the cessation of cell cycle. The progression of cell cycle is promoted by activities of various proteins, including cyclin-dependent kinase (CDK) and cyclin proteins, which work synergistically. CDK-cyclin complexes are influenced by other proteins, such as retinoblastoma (Rb) and E2F proteins. In cell cycle, both Rb and E2F proteins could be affected by one of the CDK inhibitors, that is, p21. MicroRNA (miRNA) is well known for its role in biological processes, including cell cycle. However, the contribution of miRNA in cell cycle is still poorly understood. Some miRNAs play a role in pro-proliferation and anti-proliferation.
AIM: This study was performed an in silico study analysis to reveal the relationship between miRNA-17-5p and p21 in the process of cellular senescence.
METHODS: The extensive data mining was conducted to determine the miRNA that contributes to the process of anti-aging prevention and the desired target genes through the Human Protein Atlas and cancer database. miRNA target prediction was performed using DIANA-microT-CDS. Gene function of the miRNA-17-5p target was annotated using DAVID GO.
RESULTS: The sequence of hsa-miRNA-17-5p (CAAAGUGCUUACAGUGCAGGUAG) has three attachment sites with binding types of 8 mer, 6 mer, and 8 mer at the transcription sites of 447–474, 485–513, and 1132–1154, respectively. The main profile of hsa-miRNA-17-5p showed that it bound to 3’-untranslated region and the coding region (exon).
CONCLUSIONS: The miRNA-17-5p was involved in cellular senescence by influencing the process of cell proliferation in the cell cycle pathway.Downloads
Metrics
Plum Analytics Artifact Widget Block
References
Bueno MJ, Malumbres M. MicroRNAs and the cell cycle. Biochim Biophys Acta. 2011;1812(5):592-601. PMid:21315819 DOI: https://doi.org/10.1016/j.bbadis.2011.02.002
Mens MM, Ghanbari M. Cell cycle regulation of stem cells by microRNAs. Stem Cell Rev Rep. 2018;14(5):309-22. https://doi.org/10.1007/s12015-018-9808-y PMid:29541978 DOI: https://doi.org/10.1007/s12015-018-9808-y
Kozomara A, Griffiths-Jones S. miRBase: Annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 2014;42:D68-73. https://doi.org/10.1093/nar/ gkt1181 PMid:24275495 DOI: https://doi.org/10.1093/nar/gkt1181
Dellago H, Bobbili MR, Grillari J. MicroRNA-17-5p: At the crossroads of cancer and aging-a mini review. Gerontology. 2017;63(1):20-8. https://doi.org/10.1159/000447773 PMid:27577994 DOI: https://doi.org/10.1159/000447773
Mendell JT. miRiad roles for the miR-17-92 cluster in development and disease. Cell. 2008;133(2):217-22. https://doi.org/10.1016/j.cell.2008.04.001 PMid:18423194 DOI: https://doi.org/10.1016/j.cell.2008.04.001
Hao J, Duan FF, Wang Y. MicroRNAs and RNA binding protein regulators of microRNAs in the control of pluripotency and reprogramming. Curr Opin Genet Dev. 2017;46:95-103. https://doi.org/10.1016/j.gde.2017.07.001 PMid:28753462 DOI: https://doi.org/10.1016/j.gde.2017.07.001
Malumbres M, Barbacid M. To cycle or not to cycle: A critical decision in cancer. Nat Rev Cancer. 2001;1(3):222-31. https://doi.org/10.1038/35106065 PMid:11902577 DOI: https://doi.org/10.1038/35106065
Behl C, Ziegler C. Cell Aging: Molecular Mechanisms and Implications for Disease. Ch. 2. New York: Springer; 2014. p. 9-19. DOI: https://doi.org/10.1007/978-3-642-45179-9_2
Bristow SL, Leman AR, Haase SB. Cell cyle-regulated transcription: Effectively using a genomics toolbox. In: Noguchi E, Gadaleta MC, editors. Cell Cycle Control: Mechanisms and Protocols. New York: Springer; 2014. p. 3-27. https://doi.org/10.1007/978-1-4939-0888-2_1 DOI: https://doi.org/10.1007/978-1-4939-0888-2_1
Spoerri L, Oo ZY, Larsen JE, Haass NK, Gabrielli B, Pavey S. Cell cycle checkpoint and DNA damage response defects as anticancer targets: From molecular mechanisms to therapeutic opportunities. In: Wondrak G, editor. Stress Response Pathways in Cancer. Dordrecht: Springer; 2015. p. 29-49. https://doi.org/10.1007/978-94-017-9421-3_3 DOI: https://doi.org/10.1007/978-94-017-9421-3_3
Beishline K, Azizkha-Clifford J. Interplay between the cell cycle and double-strand break response in mammalian cells. Methods Mol Biol. 2014;1170:41-59. https://doi.org/10.1007/978-1-4939-0888-2_3 PMid:24906308 DOI: https://doi.org/10.1007/978-1-4939-0888-2_3
Karimian A, Ahmadi Y, Yousefi B. Multiple functions of p21 in cell cycle, apoptosis and transcriptional regulation after DNA damage. DNA Repair (Amst). 2016;42:63-71. https://doi.org/10.1016/j.dnarep.2016.04.008 PMid:27156098 DOI: https://doi.org/10.1016/j.dnarep.2016.04.008
Leinicke JA, Longshore S, Wakeman D, Guo J, Warner BW. Regulation of retinoblastoma protein (Rb) by p21 is critical for adaptation to massive small bowel resection. J Gastrointest Surg. 2012;16(1):148-55. https://doi.org/10.1007/s11605-011-1747-8 PMid:22042567 DOI: https://doi.org/10.1007/s11605-011-1747-8
Otto T, Candido SV, Pilarz MS, Sicinska E, Bronson RT, Bowden M, et al. Cell cycle-targeting microRNAs promote differentiation by enforcing cell-cycle exit. Proc Natl Acad Sci USA. 2017;114(40):10660-5. https://doi.org/10.1073/pnas.1702914114 PMid:28923932 DOI: https://doi.org/10.1073/pnas.1702914114
Paraskevopoulou MD, Georgakilas G, Kostoulas N, Vlachos IS, Vergoulis T, Reczko M, et al. DIANA-microT web server v5.0: Service integration into miRNA functional analysis workflows. Nucleic Acids Res. 2013;41:W169-73. https://doi.org/10.1093/nar/gkt393 PMid:23680784 DOI: https://doi.org/10.1093/nar/gkt393
Huang DW, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4(1):44-57. https://doi.org/10.1038/nprot.2008.211 PMid:19131956 DOI: https://doi.org/10.1038/nprot.2008.211
Vlachos IS, Kostoulas N, Vergoulis T, Georgakilas G, Reczko M, Maragkakis M, et al. DIANA miRPath v.2.0: Investigating the combinatorial effect of microRNAs in pathways. Nucleic Acids Res. 2012;40:W498-504. https://doi.org/10.1093/nar/gks494 PMid:22649059 DOI: https://doi.org/10.1093/nar/gks494
Fang Z, Rajewsky N. The impact of miRNA target sites in coding sequences and in 3’UTRs. PLoS One. 2011;6(3):e18067. https://doi.org/10.1371/journal.pone.0018067 PMid:21445367 DOI: https://doi.org/10.1371/journal.pone.0018067
Schauble S, Klement K, Marthandan S, Munch S, Heiland I, Schuster S, et al. Quantitative model of cell cycle arrest and cellular senescence in primary human fibroblasts. Plos One. 2012;7(8):e42150. https://doi.org/10.1371/journal.pone.0042150 PMid:22879912 DOI: https://doi.org/10.1371/journal.pone.0042150
Marthandan S, Priebe S, Hemmerich P, Klement K, Diekmann S. Long-term quiescent fibroblast cells transit into senescence. Plos One. 2014;9(12):e115597. https://doi.org/10.1371/journal.pone.0115597 PMid:25531649 DOI: https://doi.org/10.1371/journal.pone.0115597
Hayflick L. Theories of biological aging. Exp Gerontol. 1985;20(3-4):145-59. PMid:3905424 DOI: https://doi.org/10.1016/0531-5565(85)90032-4
Cristofalo VJ, Lorenzini A, Allen RG, Torres C, Tresini M. Replicative senescence: A critical review. Mech Ageing Dev. 2004;125(10-11):827-48. https://doi.org/10.1016/j.mad.2004.07.010 PMid:15541776 DOI: https://doi.org/10.1016/j.mad.2004.07.010
Calcinotto A, Kohli J, Zagato E, Pellegrini L, Demaria M, Alimonti A. Cellular senescence: Aging, cancer, and injury. Physiol Rev. 2019;99(2):1047-78. https://doi.org/10.1152/physrev.00020.2018 PMid:30648461 DOI: https://doi.org/10.1152/physrev.00020.2018
Mao Z, Ke Z, Gorbunova V, Seluanov A. Replicatively senescent cells are arrested in G1 and G2 phases. Aging (Albany NY). 2012;4(6):431-5. https://doi.org/10.18632/aging.100467 PMid:22745179 DOI: https://doi.org/10.18632/aging.100467
Pajalunga D, Mazzola A, Salzano AM, Biferi MG, de Luca G, Crescenzi M. Critical requirement for cell cycle inhibitors in sustaining non-proliferative states. J Cell Biol. 2007;176(6):807-18. https://doi.org/10.1083/jcb.200608109 DOI: https://doi.org/10.1083/jcb.200608109
Beauséjour CM, Krtolica A, Galimi F, Narita M, Lowe SW, Yaswen P, et al. Reversal of human cellular senescence: Roles of the p53 and p16 pathways. EMBO J. 2003;22(16):4212-22. https://doi.org/10.1093/emboj/cdg417 PMid:12912919 DOI: https://doi.org/10.1093/emboj/cdg417
Chicas A, Wang X, Zhang C, McCurrach M, Zhao Z, Mert O, et al. Dissecting the unique role of the retinoblastoma tumor suppressor during cellular senescence. Cancer Cell. 2010;17(4):376-87. https://doi.org/10.1016/j.ccr.2010.01.023 PMid:20385362 DOI: https://doi.org/10.1016/j.ccr.2010.01.023
Hussain T, Saha D, Purohit G, Kar A, Mukherjee AK, Sharma S, et al. Transcription regulation of CDKN1A (p21/CIP1/WAF1) by TRF2 is epigenetically controlled through the REST repressor complex. Sci Rep. 2017;7(1):11541. https://doi.org/10.1038/s41598-017-11177-1 PMid:28912501 DOI: https://doi.org/10.1038/s41598-017-11177-1
Brümmer A, Hausser J. MicroRNA binding sites in the coding region of mRNAs: Extending the repertoire of post-transcriptional gene regulation. Bioessays. 2014;36(6):617-26. https://doi.org/10.1002/bies.201300104 PMid:24737341 DOI: https://doi.org/10.1002/bies.201300104
Downloads
Published
How to Cite
License
Copyright (c) 2021 Sinta Murlistyarini, Teguh Wahju Sardjono, Lukman Hakim, Sri Widyarti, Didik Huswo Utomo, Galuh Wening Permatasari, Tinny Endang Hernowaty (Author)

This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.
http://creativecommons.org/licenses/by-nc/4.0